B4 Transcription

Transcriptie

1 / 22

Slide 1: Slide

BiologieMiddelbare schoolvwoLeerjaar 3

This lesson contains 22 slides, with interactive quizzes, text slides and 1 video.

Items in this lesson

Transcriptie

Slide 1 - Slide

Slide 2 - Video

What is wrong with what the woman says at the end? Explain.

Slide 3 - Open question

Leerdoelen B4

1. You can name how transcription and protein synthesis take place in the cell

2. You can explain that genetic variation increases through spontaneous mutations

Slide 4 - Slide

Genexpression

Expression of a gene

Differs per cell whether a gene is on or off

Slide 5 - Slide

In the liver; is the gene for making head hair on or off?

Off

Slide 6 - Quiz

DNA-sequence

Order ( = sequence) of the bases in DNA

4 Bases: A, T, G and C

AGCCGTATTGACGGTATCGCGTACTCTC

| | | | | | | | | | | | | | | | | | | | | | | | | | | |

TCGGCATAACTGCCATAGCGCATGAGAG

Slide 7 - Slide

Which combination of base pairs is correct?

A - G & T - C

A- C & T - G

A - T & G - C

All combinations

Slide 8 - Quiz

DNA-sequence

The DNA sequence of a gene contains the information for making a specific protein

Proteins regulate the functioning of the body

DNA is the recipe for proteins

Slide 9 - Slide

Protein

synthesis

= making a protein in a cell

(synthesis means: putting together)

Consists of a number of steps:

1. transcription

2. translation

Slide 10 - Slide

Transcription

(DNA sequence is a 'recipe' for a protein)

Is the gene 'on'? Then the DNA sequence is read and copied

The copy is RNA

Transcription = the process by which RNA is made

Slide 11 - Slide

translation

The piece of RNA (with the recipe for a protein) leaves the cell nucleus

This is read at a ribosome and the protein is assembled.

Slide 12 - Slide

Protein synthesis - summary

DNA sequence = recipe for protein
Is the gene turned on?

Transcription: DNA sequence is read and copied,

the copy is called RNA

RNA leaves the cell nucleus, to a ribosome,

Translation: the recipe is read and the correct protein is assembled

Slide 13 - Slide

Slide 14 - Slide

DNA replication for cell division or meiosis

Slide 15 - Slide

Slide 16 - Slide

Spontaneous mutation

Error that occurs when copying DNA (during division).

This can result in abnormalities, but it doesn't have to!

Also causes genetic variation.

Chance of mutations can be increased by mutagenic factors

Slide 17 - Slide

Mutatie

Slide 18 - Slide

Mutation in body cell

Mutation in sex cell

Slide 19 - Slide

Cancer

Slide 20 - Slide

What is formed during translation?

Slide 21 - Open question

What is formed during transcription?

Slide 22 - Open question