B4 Transcription

• Biologie
• Middelbare school
• vwo
• Leerjaar 3

 B4

Transcriptie

What is wrong with what the woman says at the end? Explain.

Leerdoelen B4

1. You can name how transcription and protein synthesis take place in the cell

2. You can explain that genetic variation increases through spontaneous mutations

Genexpression

Expression of a gene

Differs per cell whether a gene is on or off

In the liver; is the gene for making head hair on or off?

1. On
2. Off

DNA-sequence

Order ( = sequence) of the bases in DNA

4 Bases: A, T, G and C

AGCCGTATTGACGGTATCGCGTACTCTC

|  | |  | |  | | | | | |  | | |  | | | | |  |  | | | | | |  | | 

TCGGCATAACTGCCATAGCGCATGAGAG

Which combination of base pairs is correct?

1. A - G & T - C
2. A- C & T - G
3. A - T & G - C
4. All combinations

DNA-sequence

The DNA sequence of a gene contains the information for making a specific protein

Proteins regulate the functioning of the body

DNA is the recipe for proteins

Protein

synthesis

= making a protein in a cell

(synthesis means: putting together)

Consists of a number of steps:

1. transcription

2. translation

Transcription

(DNA sequence is a 'recipe' for a protein)

Is the gene 'on'? Then the DNA sequence is read and copied

The copy is RNA

Transcription = the process by which RNA is made

translation

The piece of RNA (with the recipe for a protein) leaves the cell nucleus

This is read at a ribosome and the protein is assembled.

Protein synthesis - summary

• DNA sequence = recipe for protein
  
• Is the gene turned on?
  

Transcription: DNA sequence is read and copied,

the copy is called RNA

RNA leaves the cell nucleus, to a ribosome,

Translation: the recipe is read and the correct protein is assembled

DNA replication for cell division or meiosis

Spontaneous mutation

Error that occurs when copying DNA (during division).

This can result in abnormalities, but it doesn't have to!

Also causes genetic variation.

Chance of mutations can be increased by mutagenic factors

Mutatie

Mutation in body cell

Mutation in sex cell

Cancer

What is formed during translation?

What is formed during transcription?